Frequently Asked Questions - FAQ
Sequencing and capillary electrophoresis
How to correctly fill in the order form?
For each sample, ALL cells in the form row should be completed (except for the Notes column, which is optional). Incomplete data may delay the order or even prevent the order from being processed.
Please make sure to save the file before sending it!
Please pay special attention to the information contained in the headings of individual columns (red triangle in the upper right corner of the cell).
Which order form should I choose?
Do not change the internal structure or name of the downloaded form as this will prevent you from placing an order.
- In case the template DNA and primer are provided separately, select the form: TubeSeq (tubes) or PlateSeq (plates).
- In case the template DNA and primer are already mixed, select the form: ReadyToSeqTube (tubes) or ReadyToSeqPlate (plates).
- When a sequencing product obtained in another laboratory is delivered, ready for capillary electrophoresis, select the form: ReadyToLoadTube (tubes) or ReadyToLoadPlate (plates).
- If the template sent for sequencing is rich in GC, has a concentration lower than required, has secondary structures or the expected read length is longer than 700 bp, select the form: ProblemSeq.
- When capillary electrophoresis is to be performed to resolve fluorescently labeled fragments, select the form: FragmentAnalysisTube (tubes) or FragmentAnalysisPlate (plates).
Result name - how to create?
A file containing the result of the sequencing or electrophoretic separation will be given the name of the result.
The name of the result must be UNIQUE within one order!
The name may contain the following characters:
- letters [a-z A-Z (without Polish characters)]
- numbers [0-9]
- underscore, dash and period [_ -. ]
What type of size standard and capillary electrophoresis filter should I choose in the order form?
The choice of the filter type depends on the used fluorescent dyes, and the size standard depends on the length of the separated fragments. When choosing, follow the list below:
- SNaPshot products labeled with dR6G, dRROX, dRTAMRA: filter E5 (DS-02) – LIZ120 standard,
- fragments labeled 6FAM, LIZ, NED, PET, VIC: filter G5 (DS-33) – LIZ120, LIZ600 or LIZ1200 standards,
- fragments labeled 6FAM, JOE, NED, ROX: filter F (DS-32) – ROX500 standard.
If you still don’t know what to choose, please contact us: seq@amu.edu.pl.
What's the best way to sign tubes, strips and plates?
The tubes with template DNA are best signed with consecutive numbers, and the tubes with primers with successive letters of the alphabet.
The names on the TUBES must be identical to those entered on the form under “Template name/Nazwa matrycy” and “Primer name/Nazwa startera”, respectively.
STRIPS must be signed on the sides and on the lids with consecutive numbers (at least the first and last tube in each strip must be signed).
PLATE should be signed with the order number.
What is the optimal DNA concentration for sequencing?
Concentration and required volume of DNA template for sequencing:
- Plasmid – we accept purified plasmid DNA in a concentration of 90 – 130 ng/µl (minimum volume is 3 µl per one reaction). If the concentration of your sample is lower, order the sequencing using the form: ProblemSeq.
- PCR product – we accept PCR products with the photo of the gel attached as Dodatkowe informacje (minimum volume is 3 µl per one reaction).
- If you want to read a sequence above 700 bp please send the form: ProblemSeq.
What is the concentration of the sequencing primer?
Primers must have a concentration of 10 µM. Please provide 5 µl of primer per one reaction.
How to prepare a pre-mix of DNA template and primer?
Prepare the DNA template and primer mixture in the volume of 15 µl. In a tube, mix:
- 4.5 µl of 10 µM primer,
- the right amount of template depending on the type of DNA:
- 450 ng of plasmid DNA,
- 9 ng DNA/for every 100 bp of purified PCR product up to 500 bp in length,
- 15 ng DNA/for every 100 bp of purified PCR product over 500 bp in length,
- make up to 15 µl with water.
You can deliver the prepared reactions in 0.2 ml tubes, in strips or on plates.
0.2 ml TUBES should be signed with consecutive numbers, the PLATE – with the order number, and on the STRIPS, signatures must be placed on the sides and lids of at least the first and the last tube.
5 µl will be taken for the reaction. However, we please to prepare a larger volume in case of possible repetitions.
Sequencing primers available in the Laboratory
| M13F-47 | CGCCAGGGTTTTCCCAGTCACGAC |
|---|---|
| M13R | TCACACAGGAAACAGCTATGAC |
| M13F-21 | TGTAAAACGACGGCCAGT |
| M13R-21 | CAGGAAACAGCTATGACC |
| T3 promoter | ATTAACCCTCACTAAAGGGA |
| T7 universal primer | TAATACGACTCACTATAGGG |
| T7 Terminator | GCTAGTTATTGCTCAGCGG |
| SP6 | TATTTAGGTGACACTATAG |
| ITS1_fun | TCCGTAGGTGAACCTGCGG |
| ITS4_fun | TCCTCCGCTTATTGATATGC |
| ITS5 | GGAAGTAAAAGTCGTAACAAGG |
| EGFP-C | CATGGTCCTGCTGGAGTTCG |
| EGFP-N | CGTCGCCGTCCAGCTCGACCAG |
| pEGFP_CR | CAGGGGGAGGTGTGGGAGGTT |
| umes_F | GGAAGTAAAAGTCGTAACAA |
| umes_R | TCCTCCGCTTATTGATATGC |
| piNDBAC5 | GGATGTGCTGCAAGGCGATTAAGTTGG |
| piNDBAC3 | CTCGTATGTTGTGTGGAATTGTGAGC |
| WPRE_R | CATAGCGTAAAAGGACAACA |
| EF-1a_F | TCAAGCCTCAGACAGTGGTTC |
| DN_new79_R | ACACCCCGAGATTCTGAAACAAACTGGACACACCTC |
| DN_new117_F | CGTGGATAGCGGTTTGACTCACGGGGATTTCCAAG |
| LucN_R | CCTTATGCAGTTGCTCTCC |
How can I check that my DNA template is of good quality for sequencing?
The primary method for assessing the quality of a sequencing template is agarose gel electrophoresis in the presence of a DNA length standard. This applies to both plasmid DNA and PCR products after column purification.
How to describe a photo of agarose gel?
The photo of the gel must contain information of the order of samples and the volume applied, and a description of the DNA length standard.
Can I order an enzymatic purification of a PCR product prior to sequencing?
Yes, you can. To do this, use a TubeSeq or PlateSeq form and in the For purification/Do oczyszczania column, type Yes.
How to deliver samples for sequencing?
- The samples should be delivered to the laboratory packed in a string bag with an attached sheet with order number and contact info of ordering person.
- You can deliver DNA in 0.2 µl or 1.5 ml tubes, in strips or on the plate.
- The names on the tubes must be identical to those entered in the form under “Template name/Nazwa matrycy” and “Primer name/Nazwa startera”. The name of the plate must be identical to the order number.
- Any inaccuracies will require additional contact with the ordering person and may extend the order fulfillment time.
What does sequencing mean is nonstandard or problematic?
Sequencing is nonstandard or problematic, if template concentration is lower than required, the sequence is GC rich, there are secondary structures in the sequence, or the expected read length is longer than 700 bp.
Can I order a problematic template as ReadyToSeq?
No. Template and primer should be delivered in separate tubes. You should choose the ProblemSeq form.
In which program can I analyze my results?
You can use free software to view, edit and export data from sequence chromatograms:
- Sequence Scanner (Thermo Fisher Scientific),
- Finch TV (Digital World Biology),
- Chromas Lite (Technelysium).
PeakScanner (Thermo Fisher Scientific) can be used for fragment analysis.
Customer account and payments
How to create an account?
To set up an account, please send a completed form by e-mail to amuseq@amu.edu.pl. All forms are available in Forms tab. For detailed information on how to set up an account, please see Account creation and servises.
I am a student/PhD student, can I create an account?
What is the order processing time?
Who is the project manager?
How long are the results available on my account?
How long are you keeping my samples in the lab?
Can I take back my samples?
What should I do if I have a new source of payment?
What should I do if I make a mistake when placing an order?
Can I cancel my order?
What status my order may have?
- Oczekujące (= pending),
- Przyjęte (= accepted),
- Realizowane (= processing) – the order cannot be canceled when it has got this status,
- Wykonane (= processed),
- Anulowane (= canceled).